                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:189 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.16 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTCATCCACGGCATGATCGGCGACCAGAACCTGACAATCGCTTTCCCGCCGGACGT
CGATGTTCCCGCAGCACTTTCGATCACGATCGCGTCGGAAAAGCTGCATTTCTTCTCC
AGCGAAACCGGCAAGCGCATTGCCGGCAAGGCGGAGCAGCTCGGTGTGCAGTCCGCTC
AGATGGCGACGGCCTGAgcccagcgcagaaatcggcgcgatgactaaaattgcgccgattgtcaaaaccgctttgttacgatcccgat
gatagaagacctccaatatttcacgggggttttttcatATG

    Atu0309 Gene: Atu0309     GI: 17934225     BI number: Atu0309     GOG: COG3450     Description: conserved hypothetical protei   A A  C       CG GC       T  A AT        GT CG        CG |  A      |  T        A |  C       AT       G  T |  A       GC       C  C C  A       GC       A  G AT       C  C      C  C GC        CG        TG CG        GC        AT GC       |  A       GC GT       C  G       CG C  T      C  C       TG T  |      C  A       TA AT       T  C       TA GC       T  T      C  A T  C      T  T      A  A A  C      C  T       CG CG        GC        GC GC        CG        AT GC        TA        CG CG        AT        GC                         ATTTCTTCTCCAGCGAAACCGGCAAGCGCATTGCCGGCAAGGCGGAGCAGCTCGGTGTGCAGTCCGCTCAGATGGCGACGGCCTGAgcccagcgcagaaatcggcgcgatgactaaaattgcgccgattgtcaaaaccgctttgttacgatcccgatgatagaagacctccaatatttcacgggggttttttcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3450 Predicted enzyme of the cupin superfamily ... can be seen here     ..................................................................................................................