                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAATCAACGTCACCTCACCGACCGGCATTCGCGAAGTGCGTAAATTCGGCGGCGCCG
ATGTGGCGAGCCTGCTGTGGGATGCGATCGAGAAAAAACGCGACGCCCAGGATTTCTG
Aagcgatttcaatcgctcccggtttgttccgtgcgtgcaactcgatacaactaaaatacatcgcctgcgagaaattgttctctaggtgttcttgttttat
tctttgcgctgtggcacgttgcttgcgagtggccgccatggaacatgaagttccgatgatgcggccggtttgcgggggcaggccATG

    Atu0311 Gene: Atu0311     GI: 17934227     BI number: Atu0311     GOG: COG0606     Description: conserved hypothetical protei tc t  a ta at gc cg gc         c at       a  a |  c      t  a A  c      a  c Gc       g  t Tg       c  a Cg       t  a |  t      c  a |  t      a  a T  t      a  t T  g      c  a T  t       gc        tt At        ta       a  g Gc       |  t       at Gc        gc        at A  g       cg        gc C  t       gc        at C  |      |  c       gc Cg       |  t      c  | Gc        tg        gt Cg        gc        ta At        cg        cg G  |      |  a       cg Cg        cg        gt Gc        ta        cg                         ttcttgttttattctttgcgctgtggcacgttgcttgcgagtggccgccatggaacatgaagttccgatgatgcggccggtttgcgggggcaggccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0606 Predicted ATPase with chaperone activity ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:85 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G=-11.10 kcal/mol Antiterminator: Size=45 nt.     Delta G= -3.10 kcal/mol Anti-antiterminator:   Size=57 nt.     Delta G=-18.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAAATCAACGTCACCTCACCGACCGGCATTCGCGAAGTGCGTAAATTCGGCGGCGCCG ATGTGGCGAGCCTGCTGTGGGATGCGATCGAGAAAAAACGCGACGCCCAGGATTTCTG Aagcgatttcaatcgctcccggtttgttccgtgcgtgcaactcgatacaactaaaatacatcgcctgcgagaaattgttctctaggtgttcttgttttat tctttgcgctgtggcacgttgcttgcgagtggccgccatggaacatgaagttccgatgatgcggccggtttgcgggggcaggccATG     Atu0311 Gene: Atu0311     GI: 17934227     BI number: Atu0311     GOG: COG0606     Description: conserved hypothetical protei tc t  a ta at gc cg gc         c at       a  a |  c      t  a A  c      a  c Gc       g  t Tg       c  a Cg       t  a |  t      c  a |  t      a  a T  t      a  t T  g      c  a T  t       gc        tt At        ta       a  g Gc       |  t       at Gc        gc        at A  g       cg        gc C  t       gc        at C  |      |  c       gc Cg       |  t      c  | Gc        tg        gt Cg        gc        ta At        cg        cg G  |      |  a       cg Cg        cg        gt Gc        ta        cg                         ttcttgttttattctttgcgctgtggcacgttgcttgcgagtggccgccatggaacatgaagttccgatgatgcggccggtttgcgggggcaggccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0606 Predicted ATPase with chaperone activity ... can be seen here     ..................................................................................................................