Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:201 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATATTCCCTCCTCCGTGCAGAGGCGCCGGGAGAAGAAAGCGATGGCGAAGCTTTCC
GCCTTCTGAgcaacgcggcgatcacgtttgcggcggttttttgccgcaccattgactcttgtcacggcaggggctagaagcccgccgcacacgt
cagcaaggtcatttgtaacggaataatctcctccgtccatgggcgtaaaattcgaatgaaggctttttaaggccttcgaaacgcttggatgcgcgcgcgg
cttgacgtaagctggtactcgcaaatcactacaaaaaggaaaatttccATG

    Atu0331


Gene: Atu0331     GI: 17934247     BI number: Atu0331     GOG: COG1544     Description: sigma-54 modulation protei



            a
          g  t
          c  c
          g  a
  G        gc
G  C       cg
T  G       gt
A  A      c  |
G  A       at
 CG        at
 GC        cg
 AT        gc
 AT       A  |
 AT       G  |
 GC       T  |
|  C      C  |
A  G      T  |
A  C      T  |
 GC        Cg
 AT        Cg
 GT        Gc
 GC        Cg
 GT        Cg
            ttttttgccgcaccattgactcttgtcacggcaggggctagaagcccgccgcacacgtcagcaaggtcatttgtaacggaataatctcctccgtccatgggcgtaaaattcgaatgaaggctttttaaggccttcgaaacgcttggatgcgcgcgcggcttgacgtaagctggtactcgcaaatcactacaaaaaggaaaatttccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG1544 Ribosome-associated protein Y (PSrp-1) ... can be seen here

    ..................................................................................................................