                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.22 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGGCCGTGTCGTCTCCGGCGCGTAAGCTGATGAACAGCGTCAGCCGTGCGCTCAAT
GCCCAGCCCGCCGCAGCCCCGGCGCATGGCGACTGGCAGGAATTCTAGacgacctaccgttttg
cctcaaaccggcttagcctcaagcgccgccccttttcgggcggcgttcgtttttccggcactgaagacgtttgttttgcagcgcattggaaaaatatcca
ttaggtcctattatcgttgctgcatataaaccgagccgttccacgcaagcagcggcgcgcatacaggatcatggcccgGTG

    Atu0388 Gene: Atu0388     GI: 17934304     BI number: Atu0388     GOG: COG0642     Description: two component sensor kinas             a           a  a           c  c           t  c   g        cg c  a       cg a  c       gc Gc       t  t At       t  t       tt Ta        ta       t  t C  c       tg       c  c T  c       gc        cg T  g      c  c       cg A  |      c  t       cg At       a  c       gc Gt       t  a       cg Gt       c  a       cg At       c  g       gc Cg       a  |       cg Gc        gc        gt Gc        cg        at                         cgtttttccggcactgaagacgtttgttttgcagcgcattggaaaaatatccattaggtcctattatcgttgctgcatataaaccgagccgttccacgcaagcagcggcgcgcatacaggatcatggcccgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................