                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCTTCGGCGGCTTTCTCGGCATTGGCGACGATTATTACCCGCTGCCCTGGGAAAAG
CTTCACTATGACGAAGAGCTCGACGGTTACCGTATCGATCTCACCAAGGAGCAGATCG
AGAACGCGCCGCACttcaccaatctcgatgatgacgacctgctctacgccaaggaccgcaaggtctacgactactacggcgttgcaccct
attggatgtaagggtctgaaaaggcgcttccggccattctatcatcgcaagcgccagccaaaaagaacggctcccttttgggagccgttttctgTTG

    Atu0412 Gene: Atu0412     GI: 17934327     BI number: Atu0412     GOG: -------     Description: hypothetical protei cg g  c a  c a  a cg gc c  c t  a a  a c  a t  a a  |       tt ta       t  t cg        cg ta        cg ta        cg a  c       ta cg        cg cg        gc gc        gc gt        cg             ttttctgTTG     ..................................................................................................................