                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

actccaaaatcgaaaggcccgaaaccggaatggtgtcgggccttttcattttgaaccttccgcaaagacgacagcatcatccctttgacaacttgccgat
ggctcgcagaaatccggattgccgggcgaaacccgacggcggtgaggaaagccttgacgctctgctgtcgctgaccgggaagcgcgatacttttgtcaca
aaaaaacgggcccgaaagcccgtagtttttgagtgtcaaatgcgtgccgcaacactcaagccttacggcgctcgctaaccggctggtaggcgagcttcgc
ATG

    Atu0426 Gene: Atu0426     GI: 17934340     BI number: Atu0426     GOG: -------     Description: hypothetical protei   c t  a gc ta ta ta ta c  a a  a t  a a  | gc cg g  g       ga cg       c  a gc       c  a a  |       cg a  |       gc g  |       gc gc        gc gc        cg cg        at             agtttttgagtgtcaaatgcgtgccgcaacactcaagccttacggcgctcgctaaccggctggtaggcgagcttcgcATG     ..................................................................................................................