                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCGCCGTTGCCAAGGCGATATTCTTCGCGGTCGCCATGGTTAGAGGTACTTGGCCA
GATCAAGCTCAACAGTGGACGCGATTTTCGCAAGCACTGCTTTTTCGTCGTCGGAAAT
GCCGCCACTGTCCGCCACGTCCAGCGCGACCAGAAGCACGGTTTCGCTCATGTCGTGG
TCGGCCTTGAtgtcttcgatttccttgaaaagaccggccttgccaacgcggcccacggcgcggctgcacattttgtccatcgtcgtttcgatg
gcgcgggcatcgaacgcgccagaaagggcggcgTTG

    Atu0442 Gene: Atu0442     GI: 17934355     BI number: Atu0442     GOG: -------     Description: hypothetical protei             A           C  G           C  A            GT            GC            TA            TA            CG           A  |           T  |        T           G  |      T  T   A        GC       A  T G  G       AT        GC A  G       GC        CG T  T      A  |       GC TA        TA       C  A GC        TA       A  A GT        GC       G  G T  |      G  A       GC AT        TG        TA CG        AT        GC CG        CG        AT GC        CG        CG                         CTTTTTCGTCGTCGGAAATGCCGCCACTGTCCGCCACGTCCAGCGCGACCAGAAGCACGGTTTCGCTCATGTCGTGGTCGGCCTTGAtgtcttcgatttccttgaaaagaccggccttgccaacgcggcccacggcgcggctgcacattttgtccatcgtcgtttcgatggcgcgggcatcgaacgcgccagaaagggcggcgTTG     ..................................................................................................................