Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular
Characteristics of the secondary structures
Terminator: Distance to gene:61 nt. Distance to run of Ts=1 nt. Size=36 nt. Delta G=-22.70 kcal/mol
Antiterminator: Size=45 nt. Delta G=-13.50 kcal/mol
Anti-antiterminator: Size=47 nt. Delta G=-13.11 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CGGCAGGGCGGCCCCGGACCGCCCGCAGATCGTCATccgctgcgaggcccttcacacggaagacgacacaacg
cgaccggcaggcaatgccgtcagcggccctcatcgcgttcgcttcgctgcggcggatgccgttctgttcattgatcgctcgacataccaaggcccggtgc
ttcaatccggtgaccgggtgcgcgcgatggaccgggctggcgaaccggcttggtcggttgattttgtcagcgaccggcatagcaaccttatcgctgtcgc
cctgaaagagatttaggagcctcctccATG
Atu0453 --- Atu0454
Gene: Atu0453 GI: 17934366 BI number: Atu0453 GOG: ------- Description: hypothetical protein
Gene: Atu0454 GI: 17934367 BI number: Atu0454 GOG: ------- Description: hypothetical protei
a
a t
c c
t c
tg
cg
gt cg
| g g c
ta tg
gc gc
gc | g
cg g a
cg gt
cg cg ga
gt cg c a
g | a | gc
a | g | gc
a | ta tg
c | gc cg
c | gc gc
a | cg gt
t | cg gt
a | t g cg
c | a c cg
a | at at
g | cg gc
c | t | g g
t | t | tg
cg cg at
gc gc gt
cg tg cg
attttgtcagcgaccggcatagcaaccttatcgctgtcgccctgaaagagatttaggagcctcctccATG
..................................................................................................................