Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-16.90 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-18.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGTAGGCGGCAGCACTTTCGCCGATGACCGCCATGCCGAGCGCGACAGGCAGTTCC
CAAAACAGTTCAATGCCGAAGAACTTACGGCGACCTTTCCGCGCCTCATTGCCGTGCC
ACATGAAGCGGCCAAGCAGGGAGGCGATAATGGTGGTGAACGCACCACCAACCCACGC
ATTCATCAGTTCGATGAAAGAGGTGTATTTTTCCGGCATcactcgggctttccgcaatagagggcataacg
tccgcgatgccgggcaatatcaacggcggcggtccggtcgtgggtgacaaggtagGTG

    Atu0463


Gene: Atu0463     GI: 17934376     BI number: Atu0463     GOG: -------     Description: hypothetical protei


  G        AC
T  A      A  G
A  A       GC
C  G       TA
A  C       GC
 CG        GC         T
 CG        TA       G  T
 GC        GC       A  C
T  C       GC        CG
G  A       TA        TA
C  A      |  A       AT
 CG       A  C       CG
 GC       A  C       TA
 TA       T  C       TA
 TG       A  A      |  A
A  G       GC       |  G
 CG        CG       |  A
 TA        GC       A  G
 CG       G  A       CG
 CG        AT        GT
 GC        GT        CG
 CG        GC        AT
                        ATTTTTCCGGCATcactcgggctttccgcaatagagggcataacgtccgcgatgccgggcaatatcaacggcggcggtccggtcgtgggtgacaaggtagGTG
    ..................................................................................................................