                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:166 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.20 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-10.99 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagatttcatgaccacaaaaaggcgTTGGGCAAGGGTTGGCAGTCGAGCATCAATAGCGATCTGCGAA
AGCTATCTGGTCTTCGCTGGCGACCGAAACGCAAAAAGCCGCCCGGCGCGGCACGGGC
GGCTTTTTTGATAGCGAAAAATAACGTATCGATGGGGAGGCATTAAaaatatggccatcgaaatca
gccgcttacaaaatttcatagtccactaacgcccttgttaattgaccattcatcactagataggtatcaccatgatacataaagcggtctagaccggtcg
gaggatgtGTG

    Atu0466 --- Atu0465 Gene: Atu0466     GI: 17934379     BI number: Atu0466     GOG: -------     Description: hypothetical protein Gene: Atu0465     GI: 17934378     BI number: Atu0465     GOG: COG2944     Description: transcriptional regulato TC A  T TG         A CG       A  A G  T      A  A A  C       CG AT        GC AT       C  | GC       A  | CG       A  | GC       A  | T  T      G  | CG       C  | TG       C  |        C A  |      A  |      G  G GC        GC        CG CG        CG        GC G  A      |  C      |  A A  C       GC        GC T  C       GC        CG A  G       TG        CG A  A       CG        CG C  A       GC        GC T  A       CG        CG A  C      T  C       CG CG        TG        GC GC        CG        AT                         TTTTTGATAGCGAAAAATAACGTATCGATGGGGAGGCATTAAaaatatggccatcgaaatcagccgcttacaaaatttcatagtccactaacgcccttgttaattgaccattcatcactagataggtatcaccatgatacataaagcggtctagaccggtcggaggatgtGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2944 Predicted transcriptional regulator ... can be seen here     ..................................................................................................................