                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-20.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGTCCTGCGGGAATCCCTTCGTTACGCGCATTCCAAGAGCTACGTGATCGATCTCC
TTGAACGGTCGGGCTTTTCCCCCATGGAAATCCGCAAAACCACCATTCGCAAGGATGC
CGGAAAACCCCTTTCCGGCATTCTTTTTCTTGCCCGTGCCAAAGCCTGAacattccgtttcttg
ccttttttacgataggtcaggcttgcttacgtatccatcttgatcaggtgttttttgcagtgcaaaatgtgccggaaacctgagggaaaaagcgtgagca
caacgagaagcgtttacgggATG

    Atu0490 Gene: Atu0490     GI: 17934403     BI number: Atu0490     GOG: COG1284     Description: conserved hypothetical protei   C C  A C  T CG        CA CG       G  A TA        CG TA        TG TA        TA |  T       AT |  C       CG T  C      C  C CG       A  |        C GC       C  |      C  C |  A      C  |      A  C |  A      A  |       AT |  A      A  |       AT |  A      A  |       AT GC       A  |       GC GC       C  |       GC C  |       GC        CG TA        CG        CG GC        CG        GC GC        TA        TA C  A      A  A       AT AT       A  A       GT AT       A  A       GC GC        GC        AT TG        GC        AT                         TTTCTTGCCCGTGCCAAAGCCTGAacattccgtttcttgccttttttacgataggtcaggcttgcttacgtatccatcttgatcaggtgttttttgcagtgcaaaatgtgccggaaacctgagggaaaaagcgtgagcacaacgagaagcgtttacgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1284 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................