Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-18.40 kcal/mol
Antiterminator: Size=22 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACTTGGTGACCGCGCTGCTCGCCCGCAACAAATAAgccttgaagaaccgctgaagcggccgccttggccgct
ttcgccgcacccggcgcggtaatgtggccccttgccgacacacagccgctatctttcctaattatcaacgtatttaccgttgaatgttgacaggtcaggc
cctcgcgggcatgacggatgaaggccgggcatgcccggtcttttcagacagaaagtgtaaatcgcggcgcggccccctcacccggacaggccctgtcgcc
cggaaccatttgcccgaggtccgagccGTG

    Atu0498


Gene: Atu0498     GI: 17934411     BI number: Atu0498     GOG: COG0730     Description: conserved hypothetical protei


  t
t  t
a  a
t  c
 gc
 cg
 at
 at
 cg
 ta
a  a
t  t
 tg                   a
 at                 g  a
 at                 t  g
t  |                a  g
c  |                 gc
 cg                  gc
 ta        cg        cg
t  c      t  c      |  g
 ta        cg       a  g
 cg        cg        gc
 tg        cg        ta
 at        gc        at
|  c      g  a       cg
|  a       at        gc
 tg        cg        gc
 cg        ta        gc
 gc        gc        cg
                        gtcttttcagacagaaagtgtaaatcgcggcgcggccccctcacccggacaggccctgtcgcccggaaccatttgcccgaggtccgagccGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0730 Predicted permeases ... can be seen here

    ..................................................................................................................