Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-18.40 kcal/mol
Antiterminator: Size=70 nt.     Delta G=-23.21 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATTTCGTCGCTCTGGCCGAGAAGCTCAGCGAAGCCTATGGCCCGCGCTTCCAGCCGA
CGCCGCTCCTGAAGGACATGGCGGCCAAGGGCGAGACCTTCTACGGTCGCTTCGACCC
CTATGCCAGCGCCGCGAAGGCGGCATAAggcaccaagccagatcatcgaacaggcccttcggggcctgttttattatgt
ggatgccatcgcttttcgtgcatcctttgccgggctgaggcgttgaaaagcgtgaccgggcaaaacgcccgctgccacacaatcagtacgcctcaggaga
cagcgATG

    Atu0504


Gene: Atu0504     GI: 17934417     BI number: Atu0504     GOG: -------     Description: hypothetical protei


           AA
          G  G
           CG
           GC
           CG
           CG
           GC
          |  A
 CT       C  T
T  A      G  A
T  C      A  A
 CG        Cg
 CG        Cg
 AT        Gc
 GC        Ta
|  G      |  c
|  C      |  c
|  T      |  a
 AT       |  a
 GC       |  g
 CG       |  c
|  A      |  c
 GC       A  a
 GC       T  g
 GC       C  a
|  C      C  t
A  T      C  c
A  A      C  a
C  T       At
 CG        Gc        tc
 GC        Cg       t  g
 GC        Ta        cg
|  A       Ta        cg
|  G      C  c       cg
|  C      G  a       gc
 CG        Cg        gc
 GC        Tg        at
 GC        Gc        cg
 TG        Gc        at
                        tttattatgtggatgccatcgcttttcgtgcatcctttgccgggctgaggcgttgaaaagcgtgaccgggcaaaacgcccgctgccacacaatcagtacgcctcaggagacagcgATG


    ..................................................................................................................