                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-21.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.23 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGGAAGGCGTGCCGGAGATCGTCCTCGATCTCGAACTCAAGCCGAAGGGCGCGACG
GTCTATGCGCGATTGATTCTCGCCGACAGGCATGCGGCGGTCGAGATCAATCATGTCT
CGTTTCAGAACCCTTCCGAAAACCCGGATGAAAATACCGAGTTTCTCCAACGCAGCCT
GACAGCCGCCCGATTCGTGGCCTCTCGTCAGGGCGAAGCGGCTTAAccggatcagccgccacaaat
ttccatcatgtccgttgcgctcgttgaatcacgggcgcaacgacgtttttccggcgcgttTTG

    Atu0566 --- flaD Gene: Atu0566     GI: 17934477     BI number: Atu0566     GOG: -------     Description: hypothetical protein Gene: flaD     GI: 17934478     BI number: Atu0567     GOG: COG1344     Description: flagellin protein Fla             a           c  t           c  c           t  a           t  t       aa           t  g      g  t           a  t      t  c           a  c       ta           a  c       gc            cg        cg            at        tg           c  t       cg cg        cg        gc c  g       gc        cg A  a       cg        gc A  t      |  c       ta T  c      |  t       ta Ta       |  c       gc Cg        cg       c  | Gc        gt        cg Gc        at        ta Cg        cg        gc Gc        ta        tg                         tttttccggcgcgttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG1344 Flagellin and related hook-associated proteins ... can be seen here     ..................................................................................................................