                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCCGGTCGAACAGCGCCCGTCCGTCCGCCGTCAGGGCGTATCCGGTCTGGCTGCGT
AAGAAGAGGGCCTTGCCGATGCGTTCCTCCAGCTCGACCATGCGCCGCCCGACGGTCG
CGGGGCTCAAACCGGTCAGCGCGGCAGCACCCGTCAGGCCGCCGCTGCGTGACACATC
GAGGAAAAGCTGATAGGAATCCCAGGTGACGTTTTTCATcggtgaaaaacgtagcgcattttcttgcgcag
ataaatcaaaaaacggcgcgcatcatggccctccgcattcagaaggagagcgaacATG

    Atu0604 Gene: Atu0604     GI: 17934515     BI number: Atu0604     GOG: -------     Description: hypothetical protei AT A  C GC GC |  A |  G A  G T  T A  G       cg G  A      T  g T  C       At CG        Cg GT        Ta AT        Ta AT        Ta AT        Ta AT        Ta GC        Gc G  A       Cg AT        At Gc       G  a Cg        Tg Tg        Gc             gcattttcttgcgcagataaatcaaaaaacggcgcgcatcatggccctccgcattcagaaggagagcgaacATG     ..................................................................................................................