                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.11 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGTCCATcgcagaactctccggcgaaatgccgccccgtatgtgatgagcggcaaattatcagcgaagcatcgtactggtcaattattctatc
cagttccccctcgcttggtgccgtgcctgcggcaacgcggcatctgccttttcgaattggcttttgttaaagcagagtcggacagggtgatgatggtgga
tttttctgccaggtggatcaaaacaattacatcggcttcgattgcgatgttttcattgcaatcgatgttttagaaatccggcgacaatagcggggacggt
atcgcaATG

    Atu0663 Gene: Atu0663     GI: 17934573     BI number: Atu0663     GOG: COG4949     Description: conserved hypothetical protei tt t  t at gc g  t t  g gc gc ta |  g |  g |  t |  g |  g |  a |  t |  c |  a |  a |  a |  a |  c |  a                 tt |  a                t  t |  t        g        gc |  t      c  a       ta a  a      t  t       at gc       t  t       gt ta        cg        cg at        gc        gc gc       g  |       ta tg        cg        ta g  g       ta        at gc        at        gc gt        cg        cg at        at        ta                         tgttttagaaatccggcgacaatagcggggacggtatcgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4949 Uncharacterized membrane-anchored protein conserved in bacteria ... can be seen here     ..................................................................................................................