Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.11 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGTCCATcgcagaactctccggcgaaatgccgccccgtatgtgatgagcggcaaattatcagcgaagcatcgtactggtcaattattctatc
cagttccccctcgcttggtgccgtgcctgcggcaacgcggcatctgccttttcgaattggcttttgttaaagcagagtcggacagggtgatgatggtgga
tttttctgccaggtggatcaaaacaattacatcggcttcgattgcgatgttttcattgcaatcgatgttttagaaatccggcgacaatagcggggacggt
atcgcaATG

    Atu0663


Gene: Atu0663     GI: 17934573     BI number: Atu0663     GOG: COG4949     Description: conserved hypothetical protei


 tt
t  t
 at
 gc
g  t
t  g
 gc
 gc
 ta
|  g
|  g
|  t
|  g
|  g
|  a
|  t
|  c
|  a
|  a
|  a
|  a
|  c
|  a                 tt
|  a                t  t
|  t        g        gc
|  t      c  a       ta
a  a      t  t       at
 gc       t  t       gt
 ta        cg        cg
 at        gc        gc
 gc       g  |       ta
 tg        cg        ta
g  g       ta        at
 gc        at        gc
 gt        cg        cg
 at        at        ta
                        tgttttagaaatccggcgacaatagcggggacggtatcgcaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG4949 Uncharacterized membrane-anchored protein conserved in bacteria ... can be seen here

    ..................................................................................................................