Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:79 nt.    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-17.00 kcal/mol
Antiterminator:    Distance from promoter:44 nt. Size=44 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:    Distance from promoter:41 nt.    Size=14 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-tacaat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaattgctgtctcgcagcggtacaatcctcacttgaattaaacgaacttggcgggggacgccaggcgccggacctctccggggggatgatggaacggc
cttaagacgggtggtcagctgaccgcccgtttttcgtttctgtcattcaactgttatcaaaaaacggtttggtgcatttctgatatcaattcggattctc
ttaaATG

    Atu0668


Gene: Atu0668     GI: 17934578     BI number: Atu0668     GOG: -------     Description: conserved hypothetical protei


           gg
          t  a
          a  a
           gc
           tg
          a  g
           gc
           gc
           gt
           gt
          |  a
          |  a
          |  g
          g  a       gc
           gc       a  t
           cg        cg
           cg        ta
 ct        tg        gc
c  c      c  t       gc
 at       t  |       tg
 gc        cg        gc
 gc        cg        gc
 cg        at        gc
 cg        gc        cg
                        tttttcgtttctgtcattcaactgttatcaaaaaacggtttggtgcatttctgatatcaattcggattctcttaaATG


    ..................................................................................................................