                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -7.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACTACAGGCAGCGACACCAACGAACGCAAAAGCGTACCGATCAGGATGGCAAGCACC
AGATCGCCAAGCCAGGCGTGACCCGCAATCCGCACctgaaaacgctctgccagaatggcggcgcagctaactgc
cgcgcagatgagaatgcccggcagaagcgggctgagccagcggagcgaaaactgaaacggatgagcgagggtgcgatgttgtgccatgggccgacaatgc
cgtagtcgcctgttttattctatcaaataatatggcatatatcgttcgataaaatcgaatgaaacgcaATG

    Atu0672 Gene: Atu0672     GI: 17934582     BI number: Atu0672     GOG: COG0583     Description: transcriptional regulator, LysR famil tg a  t gt cg g  t t  g        c gc       g  c gc       t  g g  a      a  t a  t      a  a g  g       cg c  g       at g  g       gc a  |      c  | g  |       cg t  |       gc a  |       gc gc        gt gc        tg cg        at             tttattctatcaaataatatggcatatatcgttcgataaaatcgaatgaaacgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................