                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACGGTTTCGAGGTCGCCCAACGCATGCGCGATCTCGCCGGCGACAAACATATTCCC
ATCGTCGGTGTCATCACCCATGCCTTCGAGGGCGATCTCGACAAATGCCTGGCGTCCG
GCATGGACGACATGCTGCTGAAACCCGTAAGCCCTGACATGGTCGAGGCGGTTTTCCT
GCGGCTTATCGGCAAGGATGTCCTGCGGCTGCAGGCCTGAaatttccattgtcgggaggctatggctttt
ttaatacttgccctgcattgtgagcgcggtcgacacaggattcacgagatgcaggaATG

    Atu0701 Gene: Atu0701     GI: 17934611     BI number: Atu0701     GOG: COG2199,COG2200     Description: GGDEF family protei            TG           A  T            GC        tg            GC       t  t            AT       a  c           |  G       cg           |  C       cg AT       A  G       tg T  C       CG        ta TG        GC        tg CG        GT       a  g GC        CG       a  c G  A      T  C      A  t C  |      A  |      G  a G  |       TA       T  t TA        TG        Cg CG        CG        Cg CG        GC        Gc TA        GC        Gt                         tttttaatacttgccctgcattgtgagcgcggtcgacacaggattcacgagatgcaggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2199 FOG: GGDEF domain ... can be seen here [T] COG2200 FOG: EAL domain ... can be seen here     ..................................................................................................................