Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACGGTTTCGAGGTCGCCCAACGCATGCGCGATCTCGCCGGCGACAAACATATTCCC
ATCGTCGGTGTCATCACCCATGCCTTCGAGGGCGATCTCGACAAATGCCTGGCGTCCG
GCATGGACGACATGCTGCTGAAACCCGTAAGCCCTGACATGGTCGAGGCGGTTTTCCT
GCGGCTTATCGGCAAGGATGTCCTGCGGCTGCAGGCCTGAaatttccattgtcgggaggctatggctttt
ttaatacttgccctgcattgtgagcgcggtcgacacaggattcacgagatgcaggaATG

    Atu0701


Gene: Atu0701     GI: 17934611     BI number: Atu0701     GOG: COG2199,COG2200     Description: GGDEF family protei


           TG
          A  T
           GC        tg
           GC       t  t
           AT       a  c
          |  G       cg
          |  C       cg
 AT       A  G       tg
T  C       CG        ta
 TG        GC        tg
 CG        GT       a  g
 GC        CG       a  c
G  A      T  C      A  t
C  |      A  |      G  a
G  |       TA       T  t
 TA        TG        Cg
 CG        CG        Cg
 CG        GC        Gc
 TA        GC        Gt
                        tttttaatacttgccctgcattgtgagcgcggtcgacacaggattcacgagatgcaggaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[T] COG2199 FOG: GGDEF domain ... can be seen here
[T] COG2200 FOG: EAL domain ... can be seen here

    ..................................................................................................................