Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgaggacactcatacatgtgtgttagtaattattttcgactattcggaattaaactttcaacttttgtttgcatgaatcgatttgctgagtaacatccc
ccacaattccgggcaggggcggggcttttgcggcggcattttctcattctcgaagaacagctttgatgcagaaaacagaaacggccgccgttcagtcgat
tggtgtggattgcgttcgcgagatcgccggtctcaacacgcaattcgatatattccgcttcctgaaacggctgacggaggtctgggagtttcgcgccttc
ATG

    Atu0707 --- nrt


Gene: Atu0707     GI: 17934617     BI number: Atu0707     GOG: COG2771     Description: transcriptional regulator, LuxR family
Gene: nrt     GI: 17934618     BI number: Atu0708     GOG: COG0715     Description: ABC transporter, nucleotide binding/ATPase protei


 tc
a  g
a  a
g  t
t  t
 at
 cg
 gc
t  t
t  |
t  |
g  |
t  |
t  |
 tg
 ta
 cg
 at
|  a
|  a
|  c
a  a
c  t
t  c
t  c        g         g
t  c      g  c      g  g
c  c      g  a       cg
a  c       cg        gc
a  a       cg        gt
a  c       tg        gt
 ta        tg        gt
 ta       a  c       at
 at       a  |       cg
 at       c  |       gc
 gc       a  |      |  g
 gc        cg       g  g
 cg        cg        gc
 tg        cg        cg
 tg        cg        cg
                        cattttctcattctcgaagaacagctttgatgcagaaaacagaaacggccgccgttcagtcgattggtgtggattgcgttcgcgagatcgccggtctcaacacgcaattcgatatattccgcttcctgaaacggctgacggaggtctgggagtttcgcgccttcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG2771 DNA-binding HTH domain-containing proteins ... can be seen here
[P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here

    ..................................................................................................................