                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgaggacactcatacatgtgtgttagtaattattttcgactattcggaattaaactttcaacttttgtttgcatgaatcgatttgctgagtaacatccc
ccacaattccgggcaggggcggggcttttgcggcggcattttctcattctcgaagaacagctttgatgcagaaaacagaaacggccgccgttcagtcgat
tggtgtggattgcgttcgcgagatcgccggtctcaacacgcaattcgatatattccgcttcctgaaacggctgacggaggtctgggagtttcgcgccttc
ATG

    Atu0707 --- nrt Gene: Atu0707     GI: 17934617     BI number: Atu0707     GOG: COG2771     Description: transcriptional regulator, LuxR family Gene: nrt     GI: 17934618     BI number: Atu0708     GOG: COG0715     Description: ABC transporter, nucleotide binding/ATPase protei tc a  g a  a g  t t  t at cg gc t  t t  | t  | g  | t  | t  | tg ta cg at |  a |  a |  c a  a c  t t  c t  c        g         g t  c      g  c      g  g c  c      g  a       cg a  c       cg        gc a  a       cg        gt a  c       tg        gt ta        tg        gt ta       a  c       at at       a  |       cg at       c  |       gc gc       a  |      |  g gc        cg       g  g cg        cg        gc tg        cg        cg tg        cg        cg                         cattttctcattctcgaagaacagctttgatgcagaaaacagaaacggccgccgttcagtcgattggtgtggattgcgttcgcgagatcgccggtctcaacacgcaattcgatatattccgcttcctgaaacggctgacggaggtctgggagtttcgcgccttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2771 DNA-binding HTH domain-containing proteins ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here     ..................................................................................................................