                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGGTGTCGCAGGCCATCACCCGCCGTCGCAAACCGCAGCCCCTGCGTGGTGATGCG
GCAAAACGTCTCGATGACATGATGGAAGGCCTCGAGAGCGAGGCATTGCGCAAGGCGG
TGGAACGGCTTGGCACGGCGGTCTTGCAGAAGAAGCCGCGTGGCCGAAGCATTTGATC
GGTGCGGTTGTCCTTGACTGGTCACaattctttgacaagaagagtccagaactccgcttgtgatgaacaggccgtcgctata
tcggaatcaacggacaatagagtctattaccaacaggtgctttcATG

    Atu0800 Gene: Atu0800     GI: 17934710     BI number: Atu0800     GOG: COG1651     Description: conserved hypothetical protei CA G  G TA TA         T CG       A  T TA       C  T G  A      G  G G  |      A  A       TG CG        AT       T  T GC        GC        GC GC        CG        GC CG        CG       |  T A  C       GT       C  T CG       G  |      G  G GT       T  |       TA G  |      G  |       GC T  |       CG        GT TG        GC        CG CG        CG        TG GC        CG        AT GC        GT        GC CG        AT        TA                         CaattctttgacaagaagagtccagaactccgcttgtgatgaacaggccgtcgctatatcggaatcaacggacaatagagtctattaccaacaggtgctttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1651 Protein-disulfide isomerase ... can be seen here     ..................................................................................................................