Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGAGCACATCGACCTTCTTGGCAGCCATATTGGCGAGAAGCGGTGCAGAGGGCAGT
GCCGCTGCGGCAATTCCGGCGAGCGCGCCGCCCAGAACCTGTCGGCGGTTCAGCGGAA
ATGCATGGGAGAGATCAGTGAGCTGGGATTTGTCTTGATCGATGGGAGTCACGGCCAT
ACCTGATTCTTGTTTTGTGTTAAAAACACTCCTCCCGATCGCTCCGTTATAGCAAAGC
GCATGGCGGCACAAcccgggcccatttactccagttcaagcgtttttgcgggaatttgaccgggacatATG

    Atu0812


Gene: Atu0812     GI: 17934721     BI number: Atu0812     GOG: -------     Description: hypothetical protei


           GA
          T  T
          T  C
           CG
           TA
 GA        GT
T  G      |  G
 GC       |  G
 AT        TG         A
 CG        TA       C  T
 TG        TG       C  A
A  G       AT        GC
G  A       GC        GC
 AT       G  A      C  |
 GT        GC        AT
 AT        TG        CG
G  G       CG        TA
 GT        GC        GT
 GC       A  |       AT
T  T       GC        GC
 AT        TA        GT
 CG        GT        GT
                        GTTTTGTGTTAAAAACACTCCTCCCGATCGCTCCGTTATAGCAAAGCGCATGGCGGCACAAcccgggcccatttactccagttcaagcgtttttgcgggaatttgaccgggacatATG
    ..................................................................................................................