                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCGCGCCGAATTCACCGACGATGGTGGGGAGCGCTGTCGAGACGATCTGGTTGTCG
AGTGTGGCCATGAACATGGCCAGCATCAGAAACAGAAAAACGATGAGCCTGCGGCGGT
GATCCGACACAAGCGGCGCCACGGGGGCGGTGGACATatccatgaaaaatctcgttgagttccggcgattttg
ctgcgacaatttgtgtgctattggcatatatatgtcaatggcaagtttttgacatctgtgctatcagcgctaaatgtgatcggaaaccggcatcgaaagg
aacggctgagaGTG

    Atu0837 Gene: Atu0837     GI: 17934745     BI number: Atu0837     GOG: COG1846     Description: transcriptional regulator, MarR famil            ta           a  t            ta            at   t        cg a  t       gt t  g       gc cg        ta gc        ta ta        at gt        tg ta        cg gt        gc ta        ta             agtttttgacatctgtgctatcagcgctaaatgtgatcggaaaccggcatcgaaaggaacggctgagaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................