                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-23.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGCTGTGTTCCTGGTCACGACCGTCACCGGCGTTTCTGGCCTGTGGCTCGCCGTCTT
CGCCGATACGGGTGCCACGGTTCTGGTGACCGCCAACGCCATGCGGCTGCTCGGTTAC
TTCAACGGCCGCAAAACCTGAccccagcttttccgaaaacggccgagccccgtttatccgggctcggccggcttgttttcagcgt
attgacaaattaattgcctacaataaataccgcgtaccgccgtttccacgcgcgtgacaatagcgacaggaagtgctggcgattccacacgcgggagcaT
TG

    Atu0842 Gene: Atu0842     GI: 17934750     BI number: Atu0842     GOG: COG3774     Description: conserved hypothetical protei            cc           A  c            Gc            Ta            Cg           C  c            At   A        At         t T  C       At       t  a T  T       At       t  t GT       |  c      g  c GC       |  c      c  c C  A      |  g       cg T  A      |  a       cg C  |      |  a       cg GC       |  a       gc TG       C  a       at CG        Gc        gc GC        Cg        cg GC        Cg        cg CG        Gc        gc GC        Gc        gc TA        Cg        cg                         gcttgttttcagcgtattgacaaattaattgcctacaataaataccgcgtaccgccgtttccacgcgcgtgacaatagcgacaggaagtgctggcgattccacacgcgggagcaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3774 Mannosyltransferase OCH1 and related enzymes ... can be seen here     ..................................................................................................................