                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-22.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTGACGGCAACCGTCGGTATCGGCCCGCGCGAAGACGGCACCGGCTTCGGCATCGA
AGTGACGCTGAAGGTCAACATTCCCGGTCTTGAGCGTGAGAAAGCCGAAGAACTTGTC
GCCGCCGCACACATCGTTTGCCCATACAGCCACGCCATGCGCACCTCTACGGAAGTGC
CGGTCTCGGTGGCCTGAtaaagcgggcttacgcgcctgattataaatcttggggccgggtttatcccggccttcttgtttacagaaag
aaatatgctatattctttccaaggaaaggatatgtgccATG

    Atu0848 Gene: Atu0848     GI: 17934756     BI number: Atu0848     GOG: -------     Description: conserved hypothetical protei ac t  g t  c cg gc gc gt cg g  a a  | at at ta At G  a T  a C  a C  | Gt Gc         t T  |      t  a Gt       t  t Gt        gc Cg        gc Tg        gc Cg        cg Tg        cg Gc        gc Gc        gc Cg        gt Cg        gt             cttgtttacagaaagaaatatgctatattctttccaaggaaaggatatgtgccATG     ..................................................................................................................