                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGAAAACTGGCCATTGGTGATTCCCGCTGGCTTCAATGCATTGTCGAAAAGTCGCGC
CAAAGCCCGCGCCGCACGCTGCGCATGCAGGCAAAGACAGGAGTCTCGCACGAGAAGG
GTTGTCGAAAAAGGAATCACGCCGGCGTTTGACATgcaataaatatgttgatatcaacctaattagtcaagcgg
aacttggttgctccgcagactgtttattgcctttcagcacagaaataagcggcgcccttcggtggagcggagtgtgccgcggtgaaagacggatccaagg
aggaaagatcATG

    Atu0853 --- Atu0854 Gene: Atu0853     GI: 17934761     BI number: Atu0853     GOG: COG4312     Description: conserved hypothetical protein Gene: Atu0854     GI: 17934762     BI number: Atu0854     GOG: NOG13439     Description: conserved hypothetical protei ta a  t gc ta ta gc t  c       gg at       t  t ta       t  t a  a      c  g at       a  c at        at ta        gc a  |       gc a  |       cg c  |       gc g  |      a  a T  |      a  | A  |       cg Cg        ta At        gc Gc        at Ta        tg             tttattgcctttcagcacagaaataagcggcgcccttcggtggagcggagtgtgccgcggtgaaagacggatccaaggaggaaagatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4312 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................