                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCATGCTTTGGCCGTTCCTCGCGAAAGCGGCCTTTTCATAGTCTGGTTGTGATGATC
TTATAAGGGCAGTTTCAAGGCGCAACAACTGCTTGATGGCGATGAAGAAAAACCGCTT
GATGAAAGTTGCCGCACCATTCATggccgcttgaatgcggcactggattgttttacgttgacgttaacgtcagttattcgat
gttggcgtcgtttttcaacaggaggcaagaatgaacgaagtcgtggatcagatcgccgcaaaggcggggatcgaccctgaactggctgaaaaggccattg
gcATG

    Atu0862 Gene: Atu0862     GI: 17934770     BI number: Atu0862     GOG: NOG07177     Description: conserved hypothetical protei ga        tg t  a      t  a       ta t  t       gc       t  t cg        cg       g  t gc        at       a  c cg       t  t       cg cg       t  |       ta gc        ta        gt g  a       ta        cg T  c       gc        at At       t  g       at Cg       t  |       tg Tg       a  |       tg Ta        gt        gc At        gc        cg C  t       ta        at Cg        cg        gc At        at        tg                         tttttcaacaggaggcaagaatgaacgaagtcgtggatcagatcgccgcaaaggcggggatcgaccctgaactggctgaaaaggccattggcATG     ..................................................................................................................