                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=3 nt.   Size=17 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.46 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaggatctgcaggagatcgagaagccgttgtgagcgtgacacgcgagatttccttccatccctgtcgcccgacctgcgcgttggctttgcggacattcag
aggcgtagcgccgtccgttatcccgtgcaaccgctcagaggggacgggcagcccatgccgtcgtccagatgagaactatataccgatatgatatctgcct
gcggttgaaaccgatcgcgccgacaccagttaaagaaagactgcttcccctaaccggcctcttccgccggccatgttttcagcaaacaggagagacaccc
ATG

    Atu0867 Gene: Atu0867     GI: 17934775     BI number: Atu0867     GOG: COG0656     Description: aldo/keto reductas             g           a  a           a  a           a  a            tg            ta            gc            at aa        cg a  c      |  c gc       |  t tg       |  t ta       |  c gt       |  c gc       |  c cg       |  c        t gc       c  t      c  t t  |      a  a      t  c c  |      c  a      c  c cg       a  c       cg gc        gc        gc t  c       cg        gc cg        cg        cg ta        gc        cg                         ccatgttttcagcaaacaggagagacacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0656 Aldo/keto reductases, related to diketogulonate reductase ... can be seen here     ..................................................................................................................