Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-10.48 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGTTCCCCGTCGGCTCAGAGACAGGCAGCGCGGCTGCTCCCGCCATCTGGGAAAACT
TCGACGACTTCAAGGCCAAGGCCGCGAAGCTCGGAACGGATGCCGACGCGGTTCTCGC
CAATCTCCCCACCGATCAGGCCGGCGTCGCCACCGCCATGAAGACGCTCGGCGCCGAT
TGCGGCACCTGCCACCAGACCTATCGTCTGAAAAAATAAtcgaagcctctgaaaacgccgcccatcggcgg
cgtttttcggcacgaaaggcatctgaccgggtcaggtgagaatggggagaggggtATG

    Atu0882


Gene: Atu0882     GI: 17934790     BI number: Atu0882     GOG: COG2010     Description: Conserved hypothetical protei


           AA
          A  A
          A  A
          G  T
          T  A
          C  A
          T  t
           Gc
           Cg
           Ta
          A  a
          T  g
          C  c
          C  c
           At
           Gc
           At
           Cg
          C  a
          A  a
          C  a
          C  a
          G  c
          T  |
          C  |
          C  |
          A  |
           Cg
           Gc        at
  A        Gc       c  c
T  T       Cg        cg
C  C       Gc        cg
 CG       |  c       gc
 AT       T  c       cg
 GC        Ta        cg
 AT        At        gc
 CG        Gc        cg
                        tttttcggcacgaaaggcatctgaccgggtcaggtgagaatggggagaggggtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG2010 Cytochrome c, mono- and diheme variants ... can be seen here

    ..................................................................................................................