                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:194 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-17.60 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTCGCCTTCGAATATGCCTTCGCCCTGAAGGTCGCGGGCAAGGACGCCGTGTGAca
cgctgaatgcagaaacgggcggcgatccaatcgtcgcccgatcttattttggacgaaaatacctgcaaaaatctcgtttctgaatattttttccacaaat
tatcaactgcatcttttatttaaataccatctttgcggccagtgaatttttattttcagttgctgcaactcagaatatatcttgcacaaatacaaatata
gctcatgtattatgcgaccggaaaaaatgttccagaaatcgaATG

    Atu0896 --- Atu0895 Gene: Atu0896     GI: 17934804     BI number: Atu0896     GOG: -------     Description: hypothetical protein Gene: Atu0895     GI: 17934803     BI number: Atu0895     GOG: COG2113     Description: ABC transporter, substrate binding protei            at           a  g            gc            ta            cg           g  a        c           c  a      c  a           a  a       ta           c  |       at           A  |       gc            Gc        cg            Tg        gt GG       G  g       gc A  A       Tg        cg A  C       Gc        gc CG        Cg        gc GC        Cg        gc GC        Gc        cg |  G       Cg       a  a GT       |  a      a  | CG        At        at GT        Gc        gc CG        Gc        at                         tattttggacgaaaatacctgcaaaaatctcgtttctgaatattttttccacaaattatcaactgcatcttttatttaaataccatctttgcggccagtgaatttttattttcagttgctgcaactcagaatatatcttgcacaaatacaaatatagctcatgtattatgcgaccggaaaaaatgttccagaaatcgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2113 ABC-type proline/glycine betaine transport systems, periplasmic components ... can be seen here     ..................................................................................................................