                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:48 nt.    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -9.20 kcal/mol
Antiterminator:    Distance from promoter:13 nt. Size=45 nt.     Delta G=-19.50 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATT-catatt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATTTCACTCATcttgatctccatattgaatccgaagcgccaaggggcggatcggtcgccgatgctatcggccgacgccgctttgcgg
cgtttgttagagccgaatatgggctggtttcgtcgttcagcaaagatcgcattgcgacgattgactgttcattattcgttgacaacatcacccgctggcg
ccgctgcggctttgacttcgatcaaggcaaaggtggcgccgccggagaaatATG

    Atu0904 Gene: Atu0904     GI: 17934812     BI number: Atu0904     GOG: COG0589     Description: conserved hypothetical protei            tg           a  c           g  t           c  a           c  t ag        gc a  g       cg cg        tg cg        gc gc        gc cg        cg g  g       ta a  a      a  | at       g  | gc        gc cg        cg cg        gc         t |  t       gc       t  t t  c      |  g       cg a  g       gc        gc a  c       gt        cg gc        at        cg tg        at        gc ta        cg        cg                         tttgttagagccgaatatgggctggtttcgtcgttcagcaaagatcgcattgcgacgattgactgttcattattcgttgacaacatcacccgctggcgccgctgcggctttgacttcgatcaaggcaaaggtggcgccgccggagaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0589 Universal stress protein UspA and related nucleotide-binding proteins ... can be seen here     ..................................................................................................................