                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=2 nt.   Size=19 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-14.20 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAACTTTCGGCACCTGCGTCAAATGCGGCAAGAGGATTTCGGAGGATCGGCTGAAGG
CGGTGCCTTACACGCCGTTTTGCCAGGAATGCGCTGCGGCTTTGTGAgggtaattccggagtgcg
aggtcgcctcccgtttcttctctccgccgggataagaaacaagcagcgaccactcgttataccggcgctggatggctcaagcgaaatgaaacctctcctt
tcactacaacctcgaacgcaatttgatcgccgttaaccggccgctgtcttgttcctgtctaatattgccttcatgctTTG

    Atu0906 Gene: Atu0906     GI: 17934814     BI number: Atu0906     GOG: COG1272     Description: Hemolysin II            Ag           G  g           T  g GA        Gt G  A       Ta AT        Ta CG       T  t |  C      C  t CG        Gc GC        Gc T  T       Cg T  |      G  g T  |       Ta TG        Cg GC        Gt CG        Cg CG        Gc        gg GC        Tg       a  t |  T      A  a       gc C  T      A  |       cg AT       G  |       gc CG       G  |      t  | AT       A  |       gc TG        Cg        at TA        Cg        gc Cg        Gt        gc                         cgtttcttctctccgccgggataagaaacaagcagcgaccactcgttataccggcgctggatggctcaagcgaaatgaaacctctcctttcactacaacctcgaacgcaatttgatcgccgttaaccggccgctgtcttgttcctgtctaatattgccttcatgctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1272 Predicted membrane protein, hemolysin III homolog ... can be seen here     ..................................................................................................................