                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtcacgacgctccggtctgttcttctccccggcggggagaaggcggcagggttcatccgctcacccggattggctgtcttcgaggccgtttcttcccgta
tgaaaatgtccagccggtccatcgaccggcttttttattgccgcgcggaatttcaatagaggaaaaaaatccttctctggcgctgccgcgatccaaaaaa
tgatgtgaaatcaattggtatatttgcgggggcaaattcttacttccccgcatccgtccacaggtgtatgaattaattcctattcgtagaggagttgcat
ATG

    Atu0917 --- Atu0918 Gene: Atu0917     GI: 17934825     BI number: Atu0917     GOG: COG0593     Description: conserved hypothetical protein Gene: Atu0918     GI: 17934826     BI number: Atu0918     GOG: NOG09784     Description: conserved hypothetical protei tt c  c t  g g  a tg cg        ga gc       t  a gc       a  a tg        ta |  t       gt |  t       cg |  t      c  t |  c      c  c |  t      t  c t  t       ta        at a  c       cg       c  c gc       t  c       cg gc       t  |       ta cg       t  |       gc c  t       gc        gc c  a       cg        cg at        cg        cg cg        gt        gc ta        gc        at                         tttttattgccgcgcggaatttcaatagaggaaaaaaatccttctctggcgctgccgcgatccaaaaaatgatgtgaaatcaattggtatatttgcgggggcaaattcttacttccccgcatccgtccacaggtgtatgaattaattcctattcgtagaggagttgcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0593 ATPase involved in DNA replication initiation ... can be seen here     ..................................................................................................................