Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.67 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTGTCAGCGTCGAATTTCCCGGGAAGCCCGACATGCTGAAGACCGGCACCGTTATT
CCCCTGCCGCAGAAGCGCCCAACTCCTTGAtcttatcggtccctgatcctgccgacctctgattttcagaggcacacc
acagcattcatttgcagacggatatatccgtccgcccactgcctgcctgacttgcccacggaaacctgttttccgtgggctttttcttgcacatggttca
aaaccgcgcacacttcccctatatgctgggaaagacattgaataacggatgatacggcgcaaccATG

    Atu0919


Gene: Atu0919     GI: 17934827     BI number: Atu0919     GOG: COG2166     Description: conserved hypothetical protei


           tg
          c  c
          c  c
          g  t
          t  g        t
          c  a      c  g
          a  c      c  t
 at       c  t       at
t  a      c  t       at
 at        cg        at
 gc        gc        gc
 gc       c  c       gc
 cg       c  c       cg
 at        ta        at
 gc        gc        cg
a  c       cg        cg
 cg        cg        cg
 gc        ta        gc
                        tttttcttgcacatggttcaaaaccgcgcacacttcccctatatgctgggaaagacattgaataacggatgatacggcgcaaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG2166 SufE protein probably involved in Fe-S center assembly ... can be seen here

    ..................................................................................................................