                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.67 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTGTCAGCGTCGAATTTCCCGGGAAGCCCGACATGCTGAAGACCGGCACCGTTATT
CCCCTGCCGCAGAAGCGCCCAACTCCTTGAtcttatcggtccctgatcctgccgacctctgattttcagaggcacacc
acagcattcatttgcagacggatatatccgtccgcccactgcctgcctgacttgcccacggaaacctgttttccgtgggctttttcttgcacatggttca
aaaccgcgcacacttcccctatatgctgggaaagacattgaataacggatgatacggcgcaaccATG

    Atu0919 Gene: Atu0919     GI: 17934827     BI number: Atu0919     GOG: COG2166     Description: conserved hypothetical protei            tg           c  c           c  c           g  t           t  g        t           c  a      c  g           a  c      c  t at       c  t       at t  a      c  t       at at        cg        at gc        gc        gc gc       c  c       gc cg       c  c       cg at        ta        at gc        gc        cg a  c       cg        cg cg        cg        cg gc        ta        gc                         tttttcttgcacatggttcaaaaccgcgcacacttcccctatatgctgggaaagacattgaataacggatgatacggcgcaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2166 SufE protein probably involved in Fe-S center assembly ... can be seen here     ..................................................................................................................