                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gatgcgcaggccaagcaggcgcgcgccgatgtgaaaatcgcaacggatcagctgtcgctcatcgtccgcacgctggaacggatcgatgccctgcaacggg
tgttggcgcaggaacggcaggcgcttatggccgaggatgaaaccgagaccgaggactacgaggcggcggtggcgcatttccttggacgcatcgacgattt
ggccgagcagaaatgccgagagaggctggaggcgatcgctgcgttgggcacttccgtcgggtctggctgaggcatggcggaatttttgactgaaacccgc
TTG

    Atu0951 Gene: Atu0951     GI: 17934859     BI number: Atu0951     GOG: COG5323     Description: large terminas   t t  g g  g cg gc ta |  c |  t |  t c  c        c gc       g  t cg       g  g t  |       ta at        cg gc        tg cg        gc g  g      g  a g  g       gt at        cg gc        tg g  t       gc t  g       cg cg        cg gc        ta gt        ta             tttttgactgaaacccgcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5323 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................