Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:211 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-11.90 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCCATGGAGGCGGAAGTGGCAACGGCGATCCTGATTCACGGCATGGTGGCCGGCAG
CTTCACCGGCCGCAGCCTTGCCGATTTCTTCAGTGGCGAAGACGAGGATTGGGATGGC
GCCCGCGCCATCATCAATGGCAGCGACCGGGCGCGGCTCATAGGCAGCTACGGACGGG
CATTTCATcgcgcccttgttatggcgccgattgtcacggcgcggattgaaccggcgtcggccagatgataacccgttacaccgtgccgctgagg
ccgctcttgaactttgcatgacaggtgacaccGTG

    Atu0953


Gene: Atu0953     GI: 17934861     BI number: Atu0953     GOG: NOG09782     Description: conserved hypothetical protei


           CA        CT
          T  C      G  T
          T  G      A  C
          A  G      C  A
           GC        GC
 GC        TA        GC
G  A      C  T       CG
 TA        CG        CG
 GC        TG        GC
 cG        AT        GC
 cG       G  G       TG
a  C       CG        GC
c  G       GC       |  A
a  A       GC       |  G
g  T       CG       |  C
t  |      |  G      G  C
 gC       A  C      T  T
 gC       A  A       AT
 aT        CG        CG
 cG        GC        GC
                        CGATTTCTTCAGTGGCGAAGACGAGGATTGGGATGGCGCCCGCGCCATCATCAATGGCAGCGACCGGGCGCGGCTCATAGGCAGCTACGGACGGGCATTTCATcgcgcccttgttatggcgccgattgtcacggcgcggattgaaccggcgtcggccagatgataacccgttacaccgtgccgctgaggccgctcttgaactttgcatgacaggtgacaccGTG


    ..................................................................................................................