Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-17.10 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAACCCAGCACGCGGGTGGCGCCATTTTCCGGCGACTGGTTGCGGCGCACCTTGGT
GTCCACAGGGTTCACCGAAACCGCCTTCACCTCCACCAGAATGTCGTGCCCCTTGGCT
TCCGGCTGGGCCAGATCGATGTCGATGAGGGCATCCGCCGCGGTGATGGGCTGGCTGG
TTTTGTAACCGATGGCGCGCATgaacagtctcctttgcttgtttgcgtgcctcttacttgatacatatgaacatcaatcgcaag
aatgcacattttgtggtgatacatacaaaaaggatactgtagATG

    Atu0997


Gene: Atu0997     GI: 17934905     BI number: Atu0997     GOG: COG1733     Description: Conserved Hypothetical Protei


           TG
  C       A  T
T  C       GC
T  G       CG
 CG        TA
 GC        AT
 GT       |  G
T  |      G  A
T  |      A  G
C  |       CG
 CG        CG
 CG        GC
 CG       |  A       GA
 GC        GT       T  T
|  C       GC       G  G
|  A      T  C      G  G
|  G       CG        CG
|  A       GC        GC
T  T       GC       |  T
 GC        CG        CG
 CG       C  C       CG
 TA       T  |       GC
 GT        TG       |  T
 TG        CG        CG
 AT        GT        CG
                        TTTTGTAACCGATGGCGCGCATgaacagtctcctttgcttgtttgcgtgcctcttacttgatacatatgaacatcaatcgcaagaatgcacattttgtggtgatacatacaaaaaggatactgtagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1733 Predicted transcriptional regulators ... can be seen here

    ..................................................................................................................