                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-19.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGTGCGAAATGTGCCACCGTCGCGATTGAAAATTGCTATGAGCTTCATGTTTCCAA
CCCGATCCCGCAACGCAGCCGCGCGTAAATGCCTGGCTTCCAATAGAGTTCCGAACAC
CATcgcgtgaagatgtttttttaccgcgaatcgctctaccgcaatgcgtcatttcatgttaggggtcacttaaggtcattttcatgaccgcgcatctc
cagtcagggcagaccgttcccatacggtcttgcccttttttctgtgggccctccccgtttttcaggtcacgatgagccagtcgaatATG

    Atu1000 Gene: Atu1000     GI: 17934908     BI number: Atu1000     GOG: COG2814     Description: MFS permeas            tt cc       t  c c  a      t  t t  t      t  g ta       t  t gc        cg cg        cg cg        cg at        gc gc       |  c |  t      t  c at       t  t cg       c  c gc       t  c gc        gc gc        gc at        cg             tttttcaggtcacgatgagccagtcgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2814 Arabinose efflux permease ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.90 kcal/mol                                                                         Nomenclature/Definitions GTGGTGCGAAATGTGCCACCGTCGCGATTGAAAATTGCTATGAGCTTCATGTTTCCAA CCCGATCCCGCAACGCAGCCGCGCGTAAATGCCTGGCTTCCAATAGAGTTCCGAACAC CATcgcgtgaagatgtttttttaccgcgaatcgctctaccgcaatgcgtcatttcatgttaggggtcacttaaggtcattttcatgaccgcgcatctc cagtcagggcagaccgttcccatacggtcttgcccttttttctgtgggccctccccgtttttcaggtcacgatgagccagtcgaatATG     Atu1000 Gene: Atu1000     GI: 17934908     BI number: Atu1000     GOG: COG2814     Description: MFS permeas           cc          c  a          t  t           ta           gc           cg           cg           at           gc          |  t           at           cg           gc           gc           gc           at             tttttctgtgggccctccccgtttttcaggtcacgatgagccagtcgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2814 Arabinose efflux permease ... can be seen here     ..................................................................................................................