                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGCCGCCAACGGCTTCCGCTTCCGCGTGCCCTACGGCACCCTGCTCTGCGTCTCCG
ACAAACCGCTGCATGGCGAATTGAAGCTGCCGGGCATGGCGACGGAATTCTACCGCAC
CCAGGTCGCCCAGCATCTGCAGATCGGCATCCGCGCCGTGCAGAAACTGGCCGCCATG
CAGAAGGAAACCCTGCATTCCCGCAAGCTCAGAAGTTTTTACGAGACGGCGTTCCAGT
AAaaacagatttcgcggcaccctgccttggtgtatgatttcgaaaatcgatacaccaaggatttttctATG

    Atu1005 --- Atu1004 Gene: Atu1005     GI: 17934913     BI number: Atu1005     GOG: COG5450     Description: conserved hypothetical protein Gene: Atu1004     GI: 17934912     BI number: Atu1004     GOG: -------     Description: conserved hypothetical protei GC G  G C  T AT GC A  C G  A CG AT                   g TA         c       c  a TA       g  c       ta Ta       t  t       ta Ta       c  t       ta Ta        cg        at Gc        cg        gc |  a       at       |  g |  g       cg        ta |  a       gt        at |  t      g  a       ta At       c  |       gc At        gt        ta Gc        cg        gc A  g       ta        gc C  c      t  t       ta Tg       t  t       ta Cg        at        cg Gc        gc        cg                         atttttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG5450 Transcription regulator of the Arc/MetJ class ... can be seen here     ..................................................................................................................