Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGCCGCCGCCGCAAGCTGCTGTTGAACAAGCGAGAGATCAACCGCCTGCGCGCCGG
CATCAACCGCGACGGCATGACGCTGGTGCCGCTGAAGGTCTACTTCAACGAGAAGGGT
CGTGCGAAGCTGGAATTGGCGCTCGCCAAGGGCAAAAAGCTGCATGACAAGCGCGAGA
CCGAGAAGGAACGCGACTGGAACCGACAGAAGTCGCGGCTGTTGAAGGGTAATTCGCA
GTAGtttctgccgggtaggggtactgcggtttttccctgcatagtcccttcggcccaaggagttgggcTTG

    Atu1026


Gene: Atu1026     GI: 17934933     BI number: Atu1026     GOG: -------     Description: hypothetical protei


           GT
          G  A
          G  A
           AT
           AT
           GC
          T  |
           TG
           GC         g
           TA       c  g
           CG        cg
           GT        gt
          G  A       ta
 GC        CG        cg
C  G       Gt        tg
 TG       C  |       tg
 GC       T  |       tg
 AT       G  |      G  |
A  G       At        At
 GT        At        Ta
 AT        Gc        Gc
 CG        At        At
A  A       Cg        Cg
G  A      A  c       Gc
 CG        Gc        Cg
 CG        Cg        Tg
                        tttttccctgcatagtcccttcggcccaaggagttgggcTTG
    ..................................................................................................................