                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.00 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-28.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGAAGTGGACGAGCCCGAGCCCGATCCGGTCACGCTCGCCGCCTCCGCTGCCGATG
GCGAAGACGATGATCAGCCGGAAACCGTTACTTTCGACCAGATGTCGGAAGAAGAACT
GCTGGCCGGTATCGAAGGCCTTGTGCCGCCGGAAAAAAATGACGACTATTGAtccggtttt
atgatgcctttggcaggcggtggttaccgtctgtcaatagttgccgtcataatctgatccctattgatgcagcattgtgcgccgaccccaaggttggcgc
gctttctttttgtggaatatcgcATG

    Atu1030 Gene: Atu1030     GI: 17934937     BI number: Atu1030     GOG: COG0317     Description: GTP pyrophosphohydrolases/synthetases, RelA/SpoT famil gt g  t ta gc gc cg gt gc at cg gt gc ta ta |  t ta        ta cg       c  t |  t      c  t |  t       cg cg        ta gc        at |  c      |  g tg        gc at        ta gc        cg ta       |  c       ca at        ta       c  a ta        at        cg t  |       at        cg t  |       tg        at ta        at        gt gt        cg        cg gc       t  |       cg c  t       gc        gc cg        cg        cg ta       c  c       gc At        gc        tg Gc        tg        gc                         tttctttttgtggaatatcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0317 Guanosine polyphosphate pyrophosphohydrolases/synthetases ... can be seen here     ..................................................................................................................