                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTCAACATGGTCCGCATCGGCACTGACTTCTCAGAGCTGGCGCTGGATGTCGAAGT
ATGGGATTTGCGGCAACTGAACCAGTTGCTGTCGCAGCTCAAGGATCTCGATTGCGTG
TCGACTGTCGCGCGTGCCTTCGATTGAggcatttttgatcttctgcaaataccaaaaggccgttgttatgcgtcgagtgc
atggcagcggccttttcctgtctctggtcgttgatggggtttgcgattatcttcctttcagaaattgaaaacggaaaacgcggcgtgccggtggtcctac
accgATG

    Atu1031 Gene: Atu1031     GI: 17934938     BI number: Atu1031     GOG: -------     Description: hypothetical protei             T           C  G           A  T            GC            CG           T  |   A        GC G  T       TG GC        GC AT        CG A  C       GT         A CG        TG       G  T TA       |  C      C  T C  |      |  C       TG GT       T  T       TA AT        AT        Cg CG        GC        Cg GC        CG        Gc CG        TA        Ta                         tttttgatcttctgcaaataccaaaaggccgttgttatgcgtcgagtgcatggcagcggccttttcctgtctctggtcgttgatggggtttgcgattatcttcctttcagaaattgaaaacggaaaacgcggcgtgccggtggtcctacaccgATG     ..................................................................................................................