                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCGTTAAATTGCGGTATTGGGTGCGCAGCGACAACTATTTCGTAACGACGCGCGACG
TGACAAAAGCCATGCGGCTCGCTTTTGACGAACGCAAGGCCGAGGTAAACGCACAGCC
TGCCTGAggcctgacggttaatcctgcccgcatattttaagcgcggtggctgaacagccatcgcgtttttcatgacccgacgtcaacacccaccc
ttgcatcctgccaaagacgcctctataggtcgaaatgtaatgttattacgttacttgtttttgatcgcagactgaagagggccgaaacaATG

    Atu1049 Gene: Atu1049     GI: 17934956     BI number: Atu1049     GOG: COG3443     Description: conserved hypothetical protei   t t  t a  t       aa t  a      g  c a  a       ta cg        cg gc        gc cg        gc |  c       ta cg        gt cg        gc gt        cg tg        gc cg        cg             tttttcatgacccgacgtcaacacccacccttgcatcctgccaaagacgcctctataggtcgaaatgtaatgttattacgttacttgtttttgatcgcagactgaagagggccgaaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3443 Predicted periplasmic or secreted protein ... can be seen here     ..................................................................................................................