Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.00 kcal/mol
Antiterminator:    Distance from promoter:68 nt. Size=38 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:    Distance from promoter:33 nt.    Size=54 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttattg-tatatt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttattgttttataagtttgtttttatattggtttctttaggcgggtggggcgcgtgagggttttatttccggctcgctgttcgagtggcatgggccaacg
gggcgaatggtggtaatcttatactttccctgcgtagcagtgggatttttgattgccagatgctgaagttccggtgccggcgccgatattttacggtgaa
tcgcagATG

    Atu1114


Gene: Atu1114     GI: 17935021     BI number: Atu1114     GOG: COG2199,COG2200     Description: GGDEF family protei


 tg
a  g
 cg
 gc
 gc
 ta
g  a
a  |
 gc         t
 cg       a  c
 tg       a  t
t  |      t  t
g  |      g  a
 tg        gt
 cg        ta
 gc        gc
 cg        gt
 ta       t  |
c  a       at         t
g  |       at       g  a
 gt        gc        cg
 cg       c  |       gc
 cg        gc        ta
t  t       gc        cg
t  g       gt       |  t
 tg       |  g       cg
 at        gc        cg
 ta        cg        tg
 ta        at        ta
                        tttttgattgccagatgctgaagttccggtgccggcgccgatattttacggtgaatcgcagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[T] COG2199 FOG: GGDEF domain ... can be seen here
[T] COG2200 FOG: EAL domain ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:86 nt.    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:20 nt. Size=74 nt.     Delta G=-15.00 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcaca-tatttt. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcacaagtattgttgttaacgtttatttttgtcgttgccctagtgcaatcttaaatgataagtttaaagacgaatttttgaattattgttttataagtt
tgtttttatattggtttctttaggcgggtggggcgcgtgagggttttatttccggctcgctgttcgagtggcatgggccaacggggcgaatggtggtaat
cttatactttccctgcgtagcagtgggatttttgattgccagatgctgaagttccggtgccggcgccgatattttacggtgaatcgcagATG

    Atu1114


Gene: Atu1114     GI: 17935021     BI number: Atu1114     GOG: COG2199,COG2200     Description: GGDEF family protei


            t
          a  t
          t  g
          t  t
           at
 ta        at
c  g       gt
c  t       ta
 cg       t  t
 gc        ta
 ta        ta
 ta        tg
 gt        at
c  c       at
t  t       gt
g  t       cg
t  |       at
t  |       gt
 ta        at
 ta        at
 ta        at
 at        ta
 tg       t  t
 ta        ta
|  t       gt
t  a       at         g
g  a      |  g      t  g
 cg       |  g      g  g
 at       a  t      g  g
 at       t  t       gc
|  t       at        cg
t  a       gc        gc
t  a      t  |      g  g
g  a       at        at
 tg        at        tg
 ta        at        ta
 gc        ta        tg
 tg        tg        cg
 ta        cg        tg
                        ttttatttccggctcgctgttcgagtggcatgggccaacggggcgaatggtggtaatcttatactttccctgcgtagcagtgggatttttgattgccagatgctgaagttccggtgccggcgccgatattttacggtgaatcgcagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[T] COG2199 FOG: GGDEF domain ... can be seen here
[T] COG2200 FOG: EAL domain ... can be seen here

    ..................................................................................................................