                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-19.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAGCGTAGAGGCCCTGCACTTCGCGACCAGTGGTGGCGATGGCGAGCATCTGACGG
TTTCGATCGGTGTCGCGGCGGTGGATGGCACCGCCACAGCCGCCGAATTTTTCGGCCA
TGCCGAACTCGCTTTGCTCTCGGCCCGCAGCGGCACGCGCAACTGCGTTATCGGCTAC
TCGCGGGAGGTGGCGCAGCACAGCCGCAACAGCTATCTGGCACAGCTCGGCTCCTGAa
gcggcaatctctcgcggtgtggcgcagaggctcttgccttggccagacagttcggccaaaacggcgccATG

    Atu1118 Gene: Atu1118     GI: 17935025     BI number: Atu1118     GOG: COG0488     Description: ABC transporter, nucleotide binding/ATPase protei   G A  T CG CG AT G  G CG GC CG TA T  T                  T C  G                A  G A  |                G  G CG        GG        GC GC       C  T       TA |  G       TG        GC TA        AT        GC CG        GC        CG |  C       CG        GC |  A      T  C       GC |  T      T  G      |  A |  C       TG       |  C |  T       GC       |  A |  G      G  G       CG |  A       CG        GC |  C       AT       C  | CG       G  |      T  | CG        TG        GC GT        CG        TG GT        TA        GC AT        AT        GC GC        CG        CG                         AATTTTTCGGCCATGCCGAACTCGCTTTGCTCTCGGCCCGCAGCGGCACGCGCAACTGCGTTATCGGCTACTCGCGGGAGGTGGCGCAGCACAGCCGCAACAGCTATCTGGCACAGCTCGGCTCCTGAagcggcaatctctcgcggtgtggcgcagaggctcttgccttggccagacagttcggccaaaacggcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................