                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=23 nt.     Delta G=-13.20 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-18.91 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTTGGCGCAGATGACGCCGGCGGTATATGTATTGGCATTGGCGCCGCGCACACGGCC
GATGCGGCCATCGGCATTGATATCGACCTCCAGCGCGCAGGCGCTCGGACAGTCATGC
GGGCAGACCGTATGGCCAATACGGACTTCGGCCTTGGAGGCGGCTTTTTCAGCGGAAA
TCGGGGTCGCAACGTTCATGTCTTTTGTATATTGCATCAACGATGCGGCAAAAAGGCC
GAAGTGACGTCCATCAAGAATATTCATCCTGACCATtcatcccgataaacgccaagcgagacacatccATG

    Atu1135 Gene: Atu1135     GI: 17935042     BI number: Atu1135     GOG: COG2961     Description: conserved hypothetical protei CA G  G CG GC CG GC AT |  C CG CG TA |  C C  A CG AT                  GG GC                 C  A C  |                A  C T  |                T  T A  |                A  T T  |                A  C A  |                 CG G  |                 CG T  |        A        GC TA       C  G       GC AT       G  A      |  T CG        GC       |  T GC        GC       |  G G  G       CG       |  G C  |       GT       T  A T  |       TA       A  G A  |       AT        TG CG        CG        GC CG        TG        CG GC        GC        CG                         CTTTTTCAGCGGAAATCGGGGTCGCAACGTTCATGTCTTTTGTATATTGCATCAACGATGCGGCAAAAAGGCCGAAGTGACGTCCATCAAGAATATTCATCCTGACCATtcatcccgataaacgccaagcgagacacatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2961 Protein involved in catabolism of external DNA ... can be seen here     ..................................................................................................................