                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-13.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCCATCGCTGCAACCATGTTTGCGACGCGCAAAGTCGATTGGTCTGGAGCCGGCAC
CGCCGCGAACAGCGAGTTCTCCAGCCGCACCTGAcgcgagaccgcatggtctgaaaagcgggctgcttaacttgc
ggcccgcttttttgctgtttataggtggattactcaccacggacccggtgaaatcccgggtggctcttctggccgccgatccgccagacaacgcaaagca
ccgacattcctttttaatctaccggacacggctccggccggtgcgtcattctttgcgaaaaaatcagATG

    Atu1156 Gene: Atu1156     GI: 17935063     BI number: Atu1156     GOG: COG0659     Description: sulfate permeas ca g  t cg cg at gc at |  g |  a |  a |  a g  a cg gc cg         a A  |      a  c G  |      t  t T  |      t  t C  |       cg C  |       gc A  |       tg C  |       cg G  |       gc Cg        gc Cg        gc Gc        cg At        gc Cg        at             tttttgctgtttataggtggattactcaccacggacccggtgaaatcccgggtggctcttctggccgccgatccgccagacaacgcaaagcaccgacattcctttttaatctaccggacacggctccggccggtgcgtcattctttgcgaaaaaatcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0659 Sulfate permease and related transporters (MFS superfamily) ... can be seen here     ..................................................................................................................