                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=1 nt.   Size=17 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGTCAGTCGTTTCCATGATGCGCAGATGCGCCTGATTGGCCGCTGCGCGTGCGGCA
AAGGGATGCAGCAACACCAGTGCCGAAGAGGCCGCAATGCCGCCGAGAAGCGAACGGC
GGGTGATGGGGTGGAGAGCGAGAAGCGACGACATgggaactccttcggatgaagcttgctctgtcaggaaaacga
cagggtagaagcaatcgccgaggagtccatcaccaaaatgacaagcccgtgacagtcgggcctgttttcaaccgtttgataaattttttgtcagggaagc
gcgacggacATG

    Atu1211 Gene: Atu1211     GI: 17935116     BI number: Atu1211     GOG: -------     Description: hypothetical protei aa g  a g  a a  c cg ta        cc gc       a  a ta       c  a cg       t  a tg       a  a cg       c  t gt        cg ta        ta |  g       gc |  a      |  a ta       |  a cg       a  g gc        gc         c |  a       gc       a  a a  a      a  |      g  g at        gc       t  t gc        cg        gc tg       c  |       cg a  |       gt        cg gc        cg        cg gc        ta        gc                         ctgttttcaaccgtttgataaattttttgtcagggaagcgcgacggacATG     ..................................................................................................................