                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATGTCGGTCAGGCCATGGCGAAAAATCCGGTGCCGCTCATCATTCCCTGCCACCGT
GTTCTGGCCGCCGGCGGCAGGCTGGGCGGCTTCTCCGCACCTGGCGGAACCACCACCA
AATTGCGCATGCTCGATCTTGAAAATGCCGGCCGCAGCCGCGCCGACGAAGCGCAGGG
CAGCCTGTTTTAAagcaatgacagatcagtgcgcatgaataggcgtctgatttttgcccatttctcgtcaaattgtcgctaaattgtcaca
atacacgagcgccctctaacacaagggcgagacgtTTG

    Atu1221 Gene: Atu1221     GI: 17935126     BI number: Atu1221     GOG: NOG12851     Description: hypothetical protei            ag   C       A  c A  G      A  a G  A      T  a C  A      T  t CG        Tg GC        Ta CG        Gc GC        Ta |  A       Cg CG       C  a       aa CG       G  |      g  t G  |      A  |      t  a A  |      C  |      a  g CG        Gt        cg GC        Gc        gc C  A      |  a       cg CG       G  g       gt GC        At       t  | GC        Cg        gc C  T       Gc        at CG        Cg        cg GT        Gc        ta                         tttttgcccatttctcgtcaaattgtcgctaaattgtcacaatacacgagcgccctctaacacaagggcgagacgtTTG     ..................................................................................................................