                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:192 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.91 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-13.60 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAACGCTCGATTTCGCCGAGAAGGGCCTCGATGGCCGCCTTCGCATCGCCGTCGTGAC
ACTGGATAACGTATCCCGCGATGTCGTCAGGCCTGATGGGGATGATTTTTTCAGCGTC
GGGCATATTGGGTGAcctctcttttgttcactaaatgttctaattttagcagagagtcaacaaggcaatgcgcgccgtccttccacggt
cggccaggttaaaattgagctcatagtttcggggatttaaccggagaacccctgagcaaaagaaaggacgatggagctaatggccggcgggggacTTG

    Atu1230 Gene: Atu1230     GI: 17935134     BI number: Atu1230     GOG: -------     Description: hypothetical protei             C           A  G            AT            TA            AT            GC            GC           T  |           C  |       GC           A  |      G  C           C  |       AT           A  |       CG            GC        TA            TG        GT TT        GC        CG C  C       CG       T  | CG        TA       G  | GC        GT       T  | |  A       CG       A  | |  T      C  T      G  | C  C       GC       C  | CG        CG       G  | GC       |  T       CG GC       |  C       CG TG       T  A       CG AT       A  G       TA GC        CG        AT CG        GC        TG                         ATTTTTTCAGCGTCGGGCATATTGGGTGAcctctcttttgttcactaaatgttctaattttagcagagagtcaacaaggcaatgcgcgccgtccttccacggtcggccaggttaaaattgagctcatagtttcggggatttaaccggagaacccctgagcaaaagaaaggacgatggagctaatggccggcgggggacTTG     ..................................................................................................................